View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_201 (Length: 250)
Name: NF8810A_low_201
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_201 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 10619659 - 10619883
Alignment:
| Q |
16 |
ggacatcatacacgacaataacattgacaagtcaacgtcgattttaaaatatgaataaatttaatgtaatcacgtgggtcaatgtcaaacattgttttct |
115 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619659 |
ggacaccatacatgacaataacattgacaagtcaacgtcgattttaaaatatgaataaatttaatgtaatcacgtgggtcaatgtcaaacattgttttct |
10619758 |
T |
 |
| Q |
116 |
gtcacaacgcacatgccttctatcagaagttacaatgcagcaatgactatgaacctgtatacgaaagcaaaatgcgcagatctaatttgcaatcgatatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619759 |
gtcacaacgcacatgccttctatcagaagttacaatgcagcaatgactatgaacctgtatacgaaagcaaaatgcgcagatctaatttgcaatcgatatg |
10619858 |
T |
 |
| Q |
216 |
gtc----ttacagttgtgatgtcca |
236 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
10619859 |
gtcgcaattacagttgtgatgtcca |
10619883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University