View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_215 (Length: 250)
Name: NF8810A_low_215
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_215 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 12147794 - 12148024
Alignment:
| Q |
20 |
atcaccaatagatgcaacccttgcactcaaactagccacaactgcaccacttctttctgtcccaatgccacctccagctttaagaagaggccacatgtgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12147794 |
atcaccaatagatgcaacccttgcactcaaactagccacaactgcaccacttctttctgtcccaatgccacctccagctttaagaagaggccacatgtgc |
12147893 |
T |
 |
| Q |
120 |
tgatttagaaattcacagacttagatacaaaattttgactcaaactacatgccctaaggcttctataacctcatacacataaggaacccaattttactta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12147894 |
tgatttagaaattcacagacttagatacaaaattttgactcaaactacatgccccaaggcttctataacctcatacacataaagaacccaattttacttc |
12147993 |
T |
 |
| Q |
220 |
taaaattatcataaatagataaacaaataaa |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
12147994 |
taaaattataataaatagataaacaaataaa |
12148024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University