View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_245 (Length: 246)
Name: NF8810A_low_245
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_245 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 59 - 225
Target Start/End: Complemental strand, 13879675 - 13879509
Alignment:
| Q |
59 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg |
13879576 |
T |
|
| Q |
159 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879575 |
atgtctgtgttgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcagt |
13879509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 69 - 224
Target Start/End: Complemental strand, 13875448 - 13875293
Alignment:
| Q |
69 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtgt |
168 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtgt |
13875349 |
T |
|
| Q |
169 |
tgatcacggtactctcaggattgaggatgttcttcccggtcgaaatctgttttcag |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| |||||||||| ||||||| |
|
|
| T |
13875348 |
tgatcacggtactctcaggattaaggatgctcttccaggtcgaaatcgattttcag |
13875293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University