View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_248 (Length: 246)
Name: NF8810A_low_248
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_248 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 3511353 - 3511119
Alignment:
| Q |
14 |
agatgtcttctcaccgttaatacatttgcgctttttcaacaccatcatctgcttgtttaagtc--atattaaaaatctaacatatagcgtatcggaaggc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3511353 |
agatgtcttctcaccgttaatacatttgcgctttttcaacaccatcatctgcttgtttaagtctcatattaaaaatctaacatatagcgtatcggaaggc |
3511254 |
T |
 |
| Q |
112 |
tattccttttaggagatacgttgcatatttcttgttggatgatataaaaatatcttatattatcttgatatagtcttgtagtatcttagattattcctta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3511253 |
tattccttttaggagatacgttgcatatttcttgttggatgatataaaaatatcttatattatcttgatatagtcttgtagtatcttagattattcttta |
3511154 |
T |
 |
| Q |
212 |
aaattagttcccatatttcttagttattattatga |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3511153 |
aaattagttcccatatttcttagttattattatga |
3511119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University