View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_25 (Length: 426)
Name: NF8810A_low_25
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 8e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 164 - 299
Target Start/End: Original strand, 1129079 - 1129214
Alignment:
| Q |
164 |
catgggtcatccacattaaccaaaatttaattatctttgcagggctcgctatgaagatgctaagttcttttacgagttggacactcgtaaaaggttttca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1129079 |
catgggtcatccacattaaccaaaatttaattatctttgcagggctcgctatgaagatgctaagttcttttacgagttggacactcgtaaaaggttttca |
1129178 |
T |
 |
| Q |
264 |
gaattccgagagcaactgaaaaacattctctttcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1129179 |
gaattccgagagcaactgaaaaacattctctttcat |
1129214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University