View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_251 (Length: 246)
Name: NF8810A_low_251
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_251 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 36951422 - 36951194
Alignment:
| Q |
6 |
ccaatatagatacttccatcattccaagtaaattttccgctgccttcgcgaattccttctttccataaaccttcgtaaatatctgaattggaatacactt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36951422 |
ccaatatagatacttccatcattccaagtaaattttccgctgccttcgcgaattccttctttccataaaccttcgtaaatatctgaattggaatacgctt |
36951323 |
T |
|
| Q |
106 |
ttcgtccaatcccgtgatgagcattcatcctccatccacctgtgtaaacacagccgttcgattttgtgaatgtgccgtgccccagaagataactcccgga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
36951322 |
ttcgtccaatcccgtgatgagcattcatcctccatccacctgtgtaaacacagccgttcgattttgtgaatgtgccgtgaccatgaagataactcccgga |
36951223 |
T |
|
| Q |
206 |
tacttcgccttcatacttttctcctgatg |
234 |
Q |
| |
|
| |||||| ||||||||| ||||||||| |
|
|
| T |
36951222 |
gaattcgccctcatactttgctcctgatg |
36951194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University