View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_256 (Length: 244)
Name: NF8810A_low_256
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_256 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 34660359 - 34660584
Alignment:
| Q |
1 |
tcatggttaggttctgcacctgcaacacatggggtcctaacttcattcaattgtggttggggaagaattgggactgaaaatcatgataactacatgttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660359 |
tcatggttaggttctgcacctgcaacacatggggtcctaacttcattcaattgtggttggggaagaattgggactgaaaatcatgataactacatgttga |
34660458 |
T |
|
| Q |
101 |
tgagaaagtgataaggactaagtgcagctgcaatggtagtcatagtggaccacttttcttgtcattcatttttctccatcaatgtctaggtgaattttcc |
200 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660459 |
---gaaagtgataaggaccaagtgcagctgtaatggtagtcatagtggaccacttttcttgtcattcatttttctccatcaatgtctaggtgaattttct |
34660555 |
T |
|
| Q |
201 |
tttccaaagtatcattcatctgagataat |
229 |
Q |
| |
|
| ||| |||| ||||||||| |||||||| |
|
|
| T |
34660556 |
tctccgaagtttcattcatcagagataat |
34660584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University