View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_262 (Length: 243)
Name: NF8810A_low_262
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_262 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 235
Target Start/End: Original strand, 15420791 - 15421017
Alignment:
| Q |
9 |
tggtgttggtggcatcataactgtgtaattgatataatcattttggccggcaaattcatcgggcatatccatgtcatcatctcttgatagactcactact |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420791 |
tggtgttggtggcatcataacggtgtaattgatataatcattttggccagcaaactcaccggacatatccatgtcatcatctcttgatagactcactact |
15420890 |
T |
 |
| Q |
109 |
cgtccgcttgatgtccggcgtgtaaacttcgcccctccttgtggtggcttgccaccaaataggttcatacttattggaaagcttttgaagagttttgttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420891 |
cgtccgcttgatgtccggcgtgtaaacttcgcccctccttgtggtggcttgccaccaaataggttcatacttattggaaagcttttgaagagttttgttt |
15420990 |
T |
 |
| Q |
209 |
gaaataatgtaatgcaatgtactttgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15420991 |
gaaataatgtaatgcaatgtactttgt |
15421017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University