View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_265 (Length: 243)
Name: NF8810A_low_265
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_265 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 85 - 223
Target Start/End: Original strand, 7127620 - 7127758
Alignment:
| Q |
85 |
gttgaaattcagggacagcgacgaagaagttgcagtggcaacaattgtagaatccacaagatcaacatcaacactgtgattttcagagaactctaattgt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7127620 |
gttgaaattcagggacagcgacgaagaagttgcagtggctacaattgcagaatccacaagatcaacatcaacactgtgattttcagagaacactaattgt |
7127719 |
T |
|
| Q |
185 |
tcttgacacgttgtatccgacacgtgtgaaggctcgtgt |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7127720 |
tcttgacacgttgtatccaacacgtgtgaaggctcgtgt |
7127758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University