View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_266 (Length: 243)
Name: NF8810A_low_266
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_266 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 44912538 - 44912304
Alignment:
| Q |
1 |
tttaccaaaatgttcaatcaaatagatcttactatctgaatgcttctctgatcttagtttatattcaactactcacagcccctttagtcgttcaggaaga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44912538 |
tttaccgaaatgttcaatcaaatagatcttactatctgaatgcttctctgatcttagtttatattcaactactcacagcccctttagtcgttcaggaaga |
44912439 |
T |
 |
| Q |
101 |
caggaaccatttcatcttttgaaaaaagcaattcaatcattttaatatatttataaatcatcagatagtctccaacagtcaaacctaagaaacctataga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44912438 |
caggaaccatttcatcttttgaaaaaagcaattcaatcattttaatatatttataaatgatcagatagtctccaacagtcaaacctaagaaacctataga |
44912339 |
T |
 |
| Q |
201 |
tatataacttctatcaaatttgtttttgatgtcca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44912338 |
tatataacttctatcaaatttgtttttgatgtcca |
44912304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 33376926 - 33376974
Alignment:
| Q |
1 |
tttaccaaaatgttcaatcaaatagatcttactatctgaatgcttctct |
49 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33376926 |
tttaccaaaatgttcaatcaaatagattttactatctgaatgcttctct |
33376974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University