View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_267 (Length: 243)
Name: NF8810A_low_267
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_267 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 33399989 - 33399827
Alignment:
| Q |
20 |
tgaagagattcatttctat--tcttcaagaatttatgtgaagactacaacgaaaagaagccactcttgttagctccccgcatgagaaatgtcattcgggt |
117 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399989 |
tgaaaagattcatttctatgatcttcaagaatttatgtgaagactacaacgaaaagaagccacatttgttagctccccgcatgagaaatgtcattcgggt |
33399890 |
T |
|
| Q |
118 |
gactagaggaaataggaatttggacaatttatagcacctcaaaaggaaggaatcagctgtcct |
180 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399889 |
gactagaggaaataggaatttggacaagttatagcacctcaaaaggaaggaatcagctgtcct |
33399827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 137 - 205
Target Start/End: Original strand, 32492827 - 32492895
Alignment:
| Q |
137 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggagcattgtgtcca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32492827 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggggcattgcgtcca |
32492895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 32492759 - 32492828
Alignment:
| Q |
20 |
tgaagagattcatttctattcttcaagaatt--tatgtgaagactacaacgaaaagaagccactcttgtt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32492759 |
tgaagagattcatttctattcttcaagaatttatatgtgaagactgcaacgaaaagaagccactcttgtt |
32492828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 214 - 243
Target Start/End: Original strand, 32493567 - 32493596
Alignment:
| Q |
214 |
atcaagctgcaaggcattttaggcaaacaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32493567 |
atcaagctgcaaggcattttaggcaaacaa |
32493596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University