View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_276 (Length: 242)
Name: NF8810A_low_276
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_276 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 34 - 239
Target Start/End: Complemental strand, 28250022 - 28249817
Alignment:
| Q |
34 |
cacagcggttttcacaccgggagaactcaaacaatcattctccgtccctatgctgcgtgtggcgaaaaccgtcgatatgtacctcgctgaaatcgccgcg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28250022 |
cacagcggttttcacaccgggagaactcaaacaatcattctccgtccctatgctgcgtgtggcgaaaaccgtcgacatgtacctcgctgaaatcgccgcg |
28249923 |
T |
|
| Q |
134 |
tacggtgaactcagcatctcaaaattcaacggaatcgctgttcttattcctaaacacgcgcgtaaaatcgacgatgatctttaccgcgccgttgatgtcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28249922 |
tacggtgaactcagcatctcaaaattcaacggaatcgctgttcttattcctaaacacgcgcgtaaaatcgacgatgatctttaccgcgccgttgatatct |
28249823 |
T |
|
| Q |
234 |
atctca |
239 |
Q |
| |
|
|||||| |
|
|
| T |
28249822 |
atctca |
28249817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University