View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_294 (Length: 240)
Name: NF8810A_low_294
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_294 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 6315112 - 6315344
Alignment:
| Q |
8 |
tggtgttgtggaatatatggaagagaagaagtaagcagctttggaatatgcctggcaacaatccaacaagctatttagttccctgttgttttgaaatggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315112 |
tggtgttgtggaatatatggaagagaagaagtaagcagctttggaatatgcctggcaacaatccaacaagctatttagttccctgttgttttgaaatggc |
6315211 |
T |
|
| Q |
108 |
aaaagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaaaaccacaacaggggtacttgtcatatggcaacagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6315212 |
aaaagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtagatggaaaagaccacaacaggggtacttgtcatatggcaacagg |
6315311 |
T |
|
| Q |
208 |
tggattagtagcaacggagacttgttgggcaga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6315312 |
tggattagtagcaacggagacttgttgggcaga |
6315344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University