View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_306 (Length: 237)
Name: NF8810A_low_306
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_306 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 25 - 218
Target Start/End: Original strand, 2442696 - 2442889
Alignment:
| Q |
25 |
gaccgaactctagcttctctttgtgcaaccattttcagactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggg |
124 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| || || | |||||||||||| |
|
|
| T |
2442696 |
gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcgtgcgatagaatgatacaaaatttgtataaattgattgtaaaatggt |
2442795 |
T |
 |
| Q |
125 |
aatatagaggagccctcgatcaatttctggtaaacagggtcagtgagatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt |
218 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442796 |
aatataaagaagccctcgatcaatttctggtaaacagtgttagtgtgatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt |
2442889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 62 - 194
Target Start/End: Complemental strand, 50984328 - 50984196
Alignment:
| Q |
62 |
gactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatgggaatatagaggagccctcgatcaatttctggtaa--ac |
159 |
Q |
| |
|
||||||||||||||||||| || ||| | | ||||||||| |||||||| |||| ||||||| ||||||||| ||||||| |||||||||| | || || |
|
|
| T |
50984328 |
gactatcttgctctgcatgtgacagattaaaacaaaatttgtagaattg-attg-aaaatggtaatatagagaagccctcaatcaatttctagaaaacac |
50984231 |
T |
 |
| Q |
160 |
agggtcagtgagatgaacttgaaacaaaaacaagg |
194 |
Q |
| |
|
|| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
50984230 |
agtttcagtgagatgaagttgaaacaaaatcaagg |
50984196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 74
Target Start/End: Complemental strand, 34019952 - 34019916
Alignment:
| Q |
38 |
cttctctttgtgcaaccattttcagactatcttgctc |
74 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34019952 |
cttctctttttgcaaccattttcagactatcttgctc |
34019916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University