View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_321 (Length: 233)
Name: NF8810A_low_321
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_321 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 29 - 217
Target Start/End: Original strand, 32780935 - 32781123
Alignment:
| Q |
29 |
agacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32780935 |
agacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatgg |
32781034 |
T |
 |
| Q |
129 |
tccatctagatgggcagactaccttggaacagaaacgaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781035 |
tccatctagatgggcagactaccttggaacagaaacaaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatgatg |
32781123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University