View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_322 (Length: 232)
Name: NF8810A_low_322
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_322 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 45626279 - 45626057
Alignment:
| Q |
14 |
gaaggagtcttacactcaatatcttgattttggacactgaacgcggaaactacaaaagata----gatatgcgcatctaacaatattaacatacatgact |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626279 |
gaaggagtcttacactcaatatcttgattttggacactgaacgcggaaactacaaaagatatatagatatgcgcatctaacaatattaacatacatgact |
45626180 |
T |
 |
| Q |
110 |
atactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttggagtgtcttcaaatttaaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45626179 |
atactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttgcagtgtcttcaaatttaaaa |
45626080 |
T |
 |
| Q |
210 |
gtgtcgaggagatcagagcagga |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45626079 |
gtgtcgaggagatcagagcagga |
45626057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University