View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_336 (Length: 230)
Name: NF8810A_low_336
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_336 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 230
Target Start/End: Complemental strand, 12148282 - 12148055
Alignment:
| Q |
3 |
atagaatatcgatcaactgtatagatgggagtgtgtaatgggggctagtgatgtataactgtgagttaaaaccatctattatcatgttttatgtttctta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
12148282 |
atagaatatcgatcaactgtatagatgggagtgtgtaatgggggctagtgatgtataactgtgagctaaaaccatctattatcatgtttaatgtttctta |
12148183 |
T |
|
| Q |
103 |
caaatatgtgttagttgattttattagttatgtatattatacagaaaccacattgaacaaattggagaagtcatctttaatgcttgcatatgaggttaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12148182 |
caaatatgtgttagttgattttattagttatgtatattatacagaaaccacattgaacaaattggagaagtcatctttaatgcttgcatatgaggttaat |
12148083 |
T |
|
| Q |
203 |
gccgtcggtcctatcttggttatcaagg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12148082 |
gccgtcggtcctatcttggttatcaagg |
12148055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University