View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_337 (Length: 230)
Name: NF8810A_low_337
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_337 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 1184864 - 1185079
Alignment:
| Q |
9 |
atactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatatatttcttcttggtcaaagttttagcactaaaga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184864 |
atactgtgacattttgtatcataaagctaattatatctattgcccaattacattaaggatgaaatatatttcttcttggtcaaagttttagcactaaaga |
1184963 |
T |
|
| Q |
109 |
gatacttacagttagtgtgtagcagatgggtaactgctcatggatcattctcgcaacttgagggttttttcttgcgcctgcggcttgggaagtgggaaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184964 |
gatacttacagttagtgtgtagcagatgggtaactgctcatggatcattctcgcaacttgagggttttttcttgcgcctgcggcttgggaagtgggaaga |
1185063 |
T |
|
| Q |
209 |
agggcttggaggaact |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1185064 |
agggcttggaggaact |
1185079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 76
Target Start/End: Complemental strand, 16992934 - 16992867
Alignment:
| Q |
9 |
atactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatata |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16992934 |
atactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatata |
16992867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University