View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_339 (Length: 230)
Name: NF8810A_low_339
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_339 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 25902269 - 25902040
Alignment:
| Q |
1 |
aagtaagctttccatagattgccaannnnnnngggaaagaaatgtaagcaatggttatcaaattgatttgtctcctcaactgctgtggatacgcagggag |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25902269 |
aagtaagctttccatagattgccaatttttttgggaaagaaatgtaagcaatggttatcaaattgatttgtctcctcaactgctgtggatacgcagggag |
25902170 |
T |
|
| Q |
101 |
gcgatgctgctttaaatggcatccttcgatagctgtaacacgtctttttccctgaattatagcccaaatatcggttatagcggccattaacaaatcacta |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25902169 |
gcgatgctgctttaaatggtatccttcgatagctgtaacacgtctttttccctgaattatagcccaaatatcggttatagcggccattaacaaatcacta |
25902070 |
T |
|
| Q |
201 |
gtttgcaatatgatattgagtacaaagtga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25902069 |
gtttgcaatatgatattgagtacaaagtga |
25902040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University