View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_343 (Length: 230)
Name: NF8810A_low_343
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_343 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 21445644 - 21445873
Alignment:
| Q |
1 |
tagtcgatgcaagactaatcatttgccccttaatccgacacattcagatataacaataaatctggttagagcgtaactataagttagtgttgacacattt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21445644 |
tagtcgatgcaagactaatcatttgtaccttaatccgatacaatcagatataacaataaatctgattagagcgtaactctaagttagtgttgacatattt |
21445743 |
T |
|
| Q |
101 |
aaaatgggctttttgctggatcttcatgttagatgaaataattgtcttgttctttttatatctatcaaattttggtttctcacatttctaggtaagacaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21445744 |
aaaatggactttttgctggatcttcatgtcagatgaaataattgtcttgttctttttatatctatcaaattttggtttctcacatttttaggtaagacaa |
21445843 |
T |
|
| Q |
201 |
ttgttgtgtccataagcttgattcatatga |
230 |
Q |
| |
|
|||||||| |||||| |||||||||||||| |
|
|
| T |
21445844 |
ttgttgtgcccataaacttgattcatatga |
21445873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University