View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_344 (Length: 229)
Name: NF8810A_low_344
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_344 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 54879427 - 54879660
Alignment:
| Q |
1 |
atgattacaactgcgtttaggtgcaaat-------agatatgacacactatagttaataagtggttcatcttgtaagggcgcagtcaaacgtgattagct |
93 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54879427 |
atgattacaattgcgtttaggtgcaaattatattaagatatgacacactatagttaataagtggttcatcttgtaagggcgcagtcaaacgtgattagct |
54879526 |
T |
 |
| Q |
94 |
gggacaaccacatcttagtttta-ttttttagacttct--tcgagttgtatcttgctgtaggcacatctcgattagatcaacagttctagacttttagtg |
190 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54879527 |
gggacaaccacatcttagttttatttttttagacttcttctcgagttgtatcttgcagtaggcacatctcgattagatcaacagttctagacttttagtg |
54879626 |
T |
 |
| Q |
191 |
tacgggtggcatgaacaaatttaatgaggttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54879627 |
tacgggtggcatgaacaaatttaatgaggttttt |
54879660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University