View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_350 (Length: 229)
Name: NF8810A_low_350
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_350 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 6185655 - 6185437
Alignment:
| Q |
1 |
tgaatgtcaaaatgatcacaggtattgctaaaatatctcatttatcagtaacttaatctttcgatcgatattgactacaaaatcctctatttatacatac |
100 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||||| |||||||| |||||| || |||| || || |||||| ||||||||||||||| |
|
|
| T |
6185655 |
tgaatgtcaaaatgattacaggtattactataatatctcatttatgagtaacttgatcttt-ga---atatcgaatataaaatcgtctatttatacatac |
6185560 |
T |
|
| Q |
101 |
gagtctatacgaaaatgatggcaaactttatttctgattataataggtgacaatgttttcactgcaaaagctatagcatttgaatgtggaattcttcaac |
200 |
Q |
| |
|
|||||| | |||||||||| | |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6185559 |
aagtctacatgaaaatgatgccgaactttatctctgattataataggtgacaatgttttcactgcgaaagctatagcatttgaatgtggaattcttcaac |
6185460 |
T |
|
| Q |
201 |
ctaatcaggacacagatgaaacg |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
6185459 |
ctaatcaggacatagatgaaacg |
6185437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 145 - 222
Target Start/End: Complemental strand, 4236391 - 4236314
Alignment:
| Q |
145 |
aggtgacaatgttttcactgcaaaagctatagcatttgaatgtggaattcttcaacctaatcaggacacagatgaaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4236391 |
aggtgacaatgttttcactgcaaaagctatagcatttgaatgtggaattcttcaacctaatcaggacacggatgaaac |
4236314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4236562 - 4236517
Alignment:
| Q |
1 |
tgaatgtcaaaatgatcacaggtattgctaaaatatctcatttatc |
46 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
4236562 |
tgaatgtcaaaatgattacaggtattactaaaatatcttatttatc |
4236517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University