View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_355 (Length: 228)
Name: NF8810A_low_355
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_355 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 22 - 112
Target Start/End: Original strand, 32404193 - 32404283
Alignment:
| Q |
22 |
gatacaataaggtgcgttgtttctgtagaagggttgcataactgaaaatttcagaaactacccagaatccaaacaagctttattatcaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32404193 |
gatacaataaggtgcgttgtttctgtagaaggattgcagaactgaaaatttcagaaactacccagaatccaaacaagctttattatcaatg |
32404283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 35431810 - 35431747
Alignment:
| Q |
49 |
gaagggttgcataactgaaaatttcagaaactacccagaatccaaacaagctttattatcaatg |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35431810 |
gaagggttgcagaactgaaaatttcagaaactacccagaatccaaacaagctttattatcaatg |
35431747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University