View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_364 (Length: 225)
Name: NF8810A_low_364
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_364 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42358338 - 42358558
Alignment:
| Q |
1 |
ggatcggcgggtccaagcggttttggatccaaacccaccgccgaaccagtcacggaaacctgcggcgatctccgctccatcaccgctatcataacaggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358338 |
ggatcggcgggtccaagcggttttggatccaaatccaccgccgaacaagtcacggaaacctgcggcgatctccgctccatcaccgctatcataacaggtg |
42358437 |
T |
|
| Q |
101 |
gtacgtcaggaattggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358438 |
gtacgtcaggaattggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaag |
42358537 |
T |
|
| Q |
201 |
aggtagaatagtgacggagtg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42358538 |
aggtagaatagtgacggagtg |
42358558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University