View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8810A_low_365 (Length: 225)

Name: NF8810A_low_365
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8810A_low_365
NF8810A_low_365
[»] chr8 (1 HSPs)
chr8 (1-225)||(21314265-21314489)
[»] chr1 (1 HSPs)
chr1 (46-168)||(22412931-22413053)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 21314489 - 21314265
Alignment:
1 tcaacggggaccccaacgagacctttccactgttatcagcaccaatatgttggatcataagctgggaggatgcctggtagaagaaggcattcctgtagat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||||    
21314489 tcaacggggaccccaacgagacctttccactgttatcagcaccaatatgttggatcataaggggggaggatgcctggtagacgaaggcattcctgtagat 21314390  T
101 attttgtaccaaagcacattcgaaagattagagctaagataggagaacctgagatactgctacggaatggaagcatttgcacccagtggcacgtgcacac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||  ||||| ||||| |    
21314389 attttgtaccaaagcacattcgaaagattagagctaagataggagaacctgaggtactgctacagaatggaaccatttgcacccaacggcacatgcacgc 21314290  T
201 tcccatagggatacgtcactttgga 225  Q
    |||||||||||||||||||||||||    
21314289 tcccatagggatacgtcactttgga 21314265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 168
Target Start/End: Complemental strand, 22413053 - 22412931
Alignment:
46 tatgttggatcataagctgggaggatgcctggtagaagaaggcattcctgtagatattttgtaccaaagcacattcgaaagattagagctaagataggag 145  Q
    ||||||||||||||   ||||||||||||||||||| ||||| |  ||||||||||||||||||||||||||||||||||| || |  |||||| |||||    
22413053 tatgttggatcatagagtgggaggatgcctggtagacgaaggtaaccctgtagatattttgtaccaaagcacattcgaaaggttgggactaagaaaggag 22412954  T
146 aacctgagatactgctacggaat 168  Q
     ||||| |||| |||||||||||    
22412953 gacctgcgatattgctacggaat 22412931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University