View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_368 (Length: 224)
Name: NF8810A_low_368
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_368 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 173
Target Start/End: Original strand, 36291132 - 36291281
Alignment:
| Q |
24 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatattttttagagcacttatttttgtac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291132 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatattttttagagcacttatttttgtac |
36291231 |
T |
|
| Q |
124 |
acacttcattttctttatttcatgcactccttctacacattattttcttt |
173 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
36291232 |
acacttcattttctttatttcatgcgctcgttctacacattattttcttt |
36291281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 24 - 102
Target Start/End: Original strand, 36286075 - 36286153
Alignment:
| Q |
24 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatatttt |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
36286075 |
agcttttgcaggccttcttcatcagataacatggagccacaatgtgcaatcaagaaagatgtcactgaagtaatatttt |
36286153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 27 - 102
Target Start/End: Original strand, 36280537 - 36280612
Alignment:
| Q |
27 |
ttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatatttt |
102 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| || ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
36280537 |
ttttgcaggctttcttcatcagataacatggagcaacactttgcaatcaagaaggatgtcactcaagtattatttt |
36280612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 37177271 - 37177316
Alignment:
| Q |
167 |
tttcttttctgaaacttcttctccacaacttttaatttgatgtcca |
212 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
37177271 |
tttcttttctggaacttgttctccacaacttttaatttgatttcca |
37177316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 32854136 - 32854181
Alignment:
| Q |
167 |
tttcttttctgaaacttcttctccacaacttttaatttgatgtcca |
212 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
32854136 |
tttcctttctggaacttgttctccacaacttttaatttgatttcca |
32854181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University