View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_373 (Length: 222)
Name: NF8810A_low_373
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_373 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5414254 - 5414033
Alignment:
| Q |
1 |
tcatataccgcattagaaactacataaccagtcatgactgcatccattaagtgatagcggatgcagaaggttgtagcagaagggagagtgggcaggggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5414254 |
tcatataccgcattagaaactacataaccagtcatgactgcatccattaagtgatagcggatgcagaaggttgtagcagaagggagagtgggcaggggta |
5414155 |
T |
|
| Q |
101 |
ggggcagagaccgtagtactgatagatctgaaccatctcaggtgcccgagtctgagctccaaccccaacaacaccatggtgagggggaggatgatgattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5414154 |
ggggcagagaccgtagtactgatagatctgaaccatctcaggtgcacgagtatgagctccaaccccaacaacaccatgttgaggaggaggatgatgattc |
5414055 |
T |
|
| Q |
201 |
agataattcagaggaaaaggcg |
222 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
5414054 |
agataattcagaggaagaggcg |
5414033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University