View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_374 (Length: 221)
Name: NF8810A_low_374
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_374 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 25 - 207
Target Start/End: Original strand, 38197204 - 38197386
Alignment:
| Q |
25 |
tgatttaattaacacttctcttcctgctttggataaatgcttactcgaccattgttgtattttcctccaaactttgtctctcagatatccaaaaattgct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
38197204 |
tgatttaattaacacttctcttcctgctttggataaatgcttacccgaccattgttgtattttcctccaaactatgtctctcagatatccaaaaattgat |
38197303 |
T |
|
| Q |
125 |
ttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttgaaggatattcttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38197304 |
ttcttgttacgcgccccaccatggatggcatgcccaaatacttcctgtttcccataccttccgacacttgaaggatattcttc |
38197386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University