View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8810A_low_378 (Length: 220)

Name: NF8810A_low_378
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8810A_low_378
NF8810A_low_378
[»] chr8 (1 HSPs)
chr8 (87-219)||(42032899-42033029)
[»] chr7 (2 HSPs)
chr7 (87-219)||(46028237-46028369)
chr7 (96-192)||(19513534-19513631)
[»] chr1 (1 HSPs)
chr1 (87-146)||(52372835-52372895)


Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 87 - 219
Target Start/End: Original strand, 42032899 - 42033029
Alignment:
87 ctttgcctctacctatccggactgtcttcttgggtctctccttgcgcttttccttgctgggtgcgctggttgtggcggggcccttttcgggggccatttc 186  Q
    |||||||||||||| ||| | |||||||||||  |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||     
42032899 ctttgcctctacctttccagcctgtcttcttg--tctctccttgcgcttttccttgttgggtgcgctggttgtggtggggcccttttcgggggccatttt 42032996  T
187 ggtgttggttttcttcttctttttcttggtgtg 219  Q
    |||||||||||||||||||||||||||||||||    
42032997 ggtgttggttttcttcttctttttcttggtgtg 42033029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 87 - 219
Target Start/End: Complemental strand, 46028369 - 46028237
Alignment:
87 ctttgcctctacctatccggactgtcttcttgggtctctccttgcgcttttccttgctgggtgcgctggttgtggcggggcccttttcgggggccatttc 186  Q
    ||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||  |||||| ||||||||||||     
46028369 ctttgcctctacctatccaacttgtcttcttgggtctctccttgcgcttttccttgctgggtgtgctggttgtgacggaaccctttccgggggccatttt 46028270  T
187 ggtgttggttttcttcttctttttcttggtgtg 219  Q
    |||||||||||||||||||||||||||||||||    
46028269 ggtgttggttttcttcttctttttcttggtgtg 46028237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 19513534 - 19513631
Alignment:
96 tacctatccggactgtcttcttgggtctctccttgcgc-ttttccttgctgggtgcgctggttgtggcggggcccttttcgggggccatttcggtgtt 192  Q
    ||||||||||  |||||||||||||||||||||||||| ||||||||| |||||||||| | | ||||||| ||||||  ||||||| ||| ||||||    
19513534 tacctatccgacctgtcttcttgggtctctccttgcgctttttccttgttgggtgcgcttggtatggcgggtccctttctgggggccttttgggtgtt 19513631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 87 - 146
Target Start/End: Original strand, 52372835 - 52372895
Alignment:
87 ctttgcctctacctatccggactgtcttcttgggtctctccttgcgc-ttttccttgctgg 146  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||    
52372835 ctttgcctctacctctccggcctgtcttcttgggtctctccttgcgctttttccttgctgg 52372895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University