View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_390 (Length: 215)
Name: NF8810A_low_390
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_390 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 30590399 - 30590217
Alignment:
| Q |
20 |
tatgggtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590399 |
tatgggtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgct |
30590300 |
T |
 |
| Q |
120 |
agctgaatgtcagattgcttgatcagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590299 |
agctgaatgtcagattgcttgatcagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
30590217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University