View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_391 (Length: 214)
Name: NF8810A_low_391
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_391 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 53097118 - 53097331
Alignment:
| Q |
1 |
atactccacttctacttttcccccaatatgtgaaaattgtgattctgtggacacatttaatctgcaatatgatgacaaaacacaataaataaatatgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53097118 |
atactccacttctacttttcccccaatatgtgaaaattgcgattctgtggacacatttaatctgcaatatgatgacaaaacacaataaataaatatgaaa |
53097217 |
T |
|
| Q |
101 |
aagaatttgaaaatagagatttcacacaatgcaacttaaaaactacacaccccatttcaatagacaattcagagtcatgcacttcaactttgcaaccatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53097218 |
aagaatttgaaaatagagatttcacacaatgcaacttaaaaactacacaccccatttcaatagacaattcagagtcatgcacttcaactttgcaaccatt |
53097317 |
T |
|
| Q |
201 |
ttcactcttaacca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53097318 |
ttcactcttaacca |
53097331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University