View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_399 (Length: 210)
Name: NF8810A_low_399
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_399 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 47 - 196
Target Start/End: Complemental strand, 13889349 - 13889200
Alignment:
| Q |
47 |
gggacatctttaaagtgttcggattgtgtgacctcgtggaattacctatttaccgtcaatgaataataataatttttgtgataaggttgatgatttgtga |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13889349 |
gggacatctttaaagtgttcggattgtgtgatctcgtggagttacctattcaccgtcaatgaataataataatttttgtgataaggttgaagatttgtga |
13889250 |
T |
 |
| Q |
147 |
caattatttgttgaagttgatttataaaatgtcggttttcattcatatca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13889249 |
caattatttgttgaagttgatttataaaatgtcggttttcattcatatca |
13889200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University