View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_406 (Length: 207)
Name: NF8810A_low_406
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_406 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 47887174 - 47886998
Alignment:
| Q |
20 |
aaaagtagttgtttatttggaaggcccccctggaggcactgacattcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacaccc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887174 |
aaaagtagttgtttatttggaaggcccccctggaggcactgacattcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacaccc |
47887075 |
T |
|
| Q |
120 |
ccggattttgaggttaggctttcatcatattttctgcagattactttaatttctctttacacattcattgttactca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887074 |
ccggattttgaggttaggctttcatcatattttctgcagattactttaatttctctttacacattcattgttactca |
47886998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University