View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_412 (Length: 204)
Name: NF8810A_low_412
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_412 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0212 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 14036 - 13848
Alignment:
| Q |
16 |
tggacatcaatggtatcggacttatgagtattcagcctataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatcta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14036 |
tggacatcaatggtatcggacttatgagtattcagactataacagttccgatgaacagtcactcacttttgacagttatacgattccggaagatgatcta |
13937 |
T |
|
| Q |
116 |
gaattgggtcaatcacgtttattagaagaggacaatagagtggttgtactcaccaaaactcatctacgtattattgtaacatctgctga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13936 |
gaattgggtcaatcacgtttattagaagtggacaatagagtggttgtaccagccaaaactcatctacgtattattgtaacatctgctga |
13848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 74 - 197
Target Start/End: Original strand, 1677528 - 1677651
Alignment:
| Q |
74 |
tcactcacttttgacagttatacgattccggaagatgatctagaattgggtcaatcacgtttattagaagaggacaatagagtggttgtactcaccaaaa |
173 |
Q |
| |
|
|||||||||||||| | |||||||||| |||| |||||||| |||| ||||||||| ||||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
1677528 |
tcactcacttttgaaacttatacgattttggaaaatgatctataattaggtcaatcatgtttattagaattggacaatagagtgattgtaccagccaaaa |
1677627 |
T |
|
| Q |
174 |
ctcatctacgtattattgtaacat |
197 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1677628 |
ctcatctacgtattattgtaacat |
1677651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 34584489 - 34584443
Alignment:
| Q |
16 |
tggacatcaatggtatcggacttatgagtattcagcctataacagtt |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34584489 |
tggacatcaatggtatcggacttatgagtattcagactataacagtt |
34584443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University