View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_418 (Length: 202)
Name: NF8810A_low_418
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_418 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 177
Target Start/End: Complemental strand, 1418949 - 1418780
Alignment:
| Q |
9 |
atggacatcaatttagaggggtttgtataagtaagtgtaggaagtacatatggggg-tataagaaagattttacaaaatccctttcaattgaatataagg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418949 |
atggtcatcaatttagaggggtttgtataagtaagtgtaggaagtacatatggggggtataagaaagattttacaaaatccctttcaattgaatataagg |
1418850 |
T |
|
| Q |
108 |
atattgccgcaaaacgggagctaaatcctgtcgtgtcgtttaagagctacttcttccttcactcttgtct |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418849 |
atattgccgcaaaacgggagctaaatcctgtcgtgtcgtttaagagctacttcttccttcactcttgtct |
1418780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University