View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_419 (Length: 202)
Name: NF8810A_low_419
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_419 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 45853260 - 45853427
Alignment:
| Q |
20 |
tgttgtagaagaggtgaagttgttaccgtgttctcatcgatatcatggtgattgcataatgccttggttggggattaggaatacttgtcctgtttgtcgc |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45853260 |
tgttgtagaagaggtgaagttgttgccgtgttctcatcgatatcatggtgattgcataatgccttggttggggattaggaatacttgtcctgtttgtcgc |
45853359 |
T |
|
| Q |
120 |
tgtgagtttcctactgatgatgctgattatgaacgtaggaaagctccaatgttggctcggagcgcttg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45853360 |
tgtgagtttcctactgatgatgctgattatgaacgtaggaaagctccaatgttggcccggagcgcttg |
45853427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 148
Target Start/End: Original strand, 6041912 - 6041997
Alignment:
| Q |
63 |
catggtgattgcataatgccttggttggggattaggaatacttgtcctgtttgtcgctgtgagtttcctactgatgatgctgatta |
148 |
Q |
| |
|
||||||||||| || |||| |||||| ||| |||||||||||||||||||||| | |||||| || || ||||||| |||||| |
|
|
| T |
6041912 |
catggtgattgtattttgccgtggttgaatattcggaatacttgtcctgtttgtcggtatgagttaccaacggatgatgatgatta |
6041997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 151
Target Start/End: Original strand, 29164904 - 29164952
Alignment:
| Q |
103 |
cttgtcctgtttgtcgctgtgagtttcctactgatgatgctgattatga |
151 |
Q |
| |
|
|||||||||||||||| | |||||| ||||| |||||| |||||||||| |
|
|
| T |
29164904 |
cttgtcctgtttgtcgttttgagttgcctacagatgatcctgattatga |
29164952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University