View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810A_low_75 (Length: 345)
Name: NF8810A_low_75
Description: NF8810A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810A_low_75 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 59 - 249
Target Start/End: Complemental strand, 48571084 - 48570894
Alignment:
| Q |
59 |
ctctataacgctgatcactctcttattagataaaactgttatgggtttcataatttggaatgagtcccgcgtaaagtagtcggatccacattgatttcac |
158 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48571084 |
ctctataacactgatcactctcttattagataaaactgttatgggtttcatactttggaatcagtcctacgtaaagtagtcggatccacattgatttcac |
48570985 |
T |
|
| Q |
159 |
acggtgtgtgattgagtgttagagagaatgtcgttgtcattcctcttccactataacttttgattcgatacctctatgtaggttgtgtgac |
249 |
Q |
| |
|
||| || ||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
48570984 |
acgttgaatgattgaatgttagagaaaatgttgttgtcattcctcttccactataacttttgatttgatacctctaagtaggttgtgtgac |
48570894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University