View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8810_high_5 (Length: 256)
Name: NF8810_high_5
Description: NF8810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8810_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 64 - 240
Target Start/End: Complemental strand, 36328586 - 36328410
Alignment:
| Q |
64 |
ttccaaataagccacttttatgattaactaccatttatattgtaattgtatgatttactcttaaaagtaagtttgatataaaaataatgtaaaattttca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36328586 |
ttccaaataagccacttttatgattaactaccatttatattgtaattgtatgatttactcttaaaagtaagtttgatataaaaataatgtaaaattttca |
36328487 |
T |
 |
| Q |
164 |
accccaacacatgatgtgtgttctggtttcacggcagggatagtgagccaaaattgatttcatccgcataaatttat |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36328486 |
accccaacacatggtgtgtgttctggtttcacggcagggatagtgagccaaaattgatttcatccgcataaatttat |
36328410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University