View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8811_low_18 (Length: 240)
Name: NF8811_low_18
Description: NF8811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8811_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 9090436 - 9090617
Alignment:
| Q |
18 |
gtaaatgttctgcacacacactaatacacatgtatgtgtgtatgttatgtcagaattggattccctaatgtaacagcgtcacacaactcccagctgtttg |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9090436 |
gtaaatgttctgcaca--cactaatacacatgtatgtgtgtatgttatgtcggaattggattccctaatgtaacagcgtcacacaactcccagccgtttg |
9090533 |
T |
|
| Q |
118 |
atctggatctttgactgatatcattttaccgcatgacactaactgcgtgattatgttgaatcaacggccgtgattaactattgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9090534 |
atctggatctttgactgatatcattttaccgcatgacactaactgtgtgattatgttgaattaacggccgtgattaactattgc |
9090617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University