View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8811_low_20 (Length: 230)
Name: NF8811_low_20
Description: NF8811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8811_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44721773 - 44721551
Alignment:
| Q |
1 |
attactggtctgtaagcttcagttttatccgtttatcgtcatgtttttgctgaagtatctgataactttctcaagttaattacttcctggctgcattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44721773 |
attactggtctgtaagcttcagttttatccgtttatcgtcatgtttttgctgaagtatctgataactttctcaagttaattacttcctggctgcattcat |
44721674 |
T |
 |
| Q |
101 |
ttattcaataaagggtggcgttaaaactgaagggtcatattatataccctattccaaattaggcttgccaacttctagtgcaagctaactccttttgtac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44721673 |
ttattcaataaagggtggcgttaaaactgaagggtcatattatataccctattccaaattacgcttgccaacttctagtgcaagctaactccttttgtac |
44721574 |
T |
 |
| Q |
201 |
atttaatcatcttcttctcactc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44721573 |
atttaatcatcttcttctcactc |
44721551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 143 - 212
Target Start/End: Complemental strand, 38673267 - 38673198
Alignment:
| Q |
143 |
tataccctattccaaattaggcttgccaacttctagtgcaagctaactccttttgtacatttaatcatct |
212 |
Q |
| |
|
||||||||||||| ||||| | |||| || ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38673267 |
tataccctattcctaattatgtttgcaaagttctagtacaagctaactccttttgtacatttaatcatct |
38673198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 38673411 - 38673359
Alignment:
| Q |
22 |
gttttatccgtttatcgtcatgtttttgctgaagtatctgataactttctcaa |
74 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||| ||||||| |
|
|
| T |
38673411 |
gttttatccgtttatcgtcttgtttttgctgaagcatcggataatgttctcaa |
38673359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University