View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8811_low_22 (Length: 225)
Name: NF8811_low_22
Description: NF8811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8811_low_22 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 15796509 - 15796737
Alignment:
| Q |
1 |
gtccaaccgggtaaataaaattagctgttaaattacaaactttggaaattataaccattcactttgacttccttcnnnnnnnnnnnnncattcactttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15796509 |
gtccaaccgggtaaataaaattagctgttaaattacaaactttggaaattataaccattcaatttgacttccttcaaaaaaaaataaacattcactttaa |
15796608 |
T |
 |
| Q |
101 |
gtaac----tattttgcattaaactctgaatcctatttgcctgattaaaacgacgcctttttatctttctttggacggaaacatgcaaccaaggttctct |
196 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15796609 |
ctaactaactattttgcattaaactctgaatcctatttgcctgattaaaacgacgccgttttatctttctttggacggaaacatgcaaccaaggttctct |
15796708 |
T |
 |
| Q |
197 |
gcatcatcataaggtcgtgctttatcatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15796709 |
gcatcatcataaggtcgtgctttatcatt |
15796737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University