View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8812_low_3 (Length: 255)
Name: NF8812_low_3
Description: NF8812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8812_low_3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 4 - 255
Target Start/End: Complemental strand, 47592958 - 47592707
Alignment:
| Q |
4 |
ttcttagaagtctcagctattgaagaatcctaaaacaacataatgatcatgcatgcacataatcacatgaaacaagttcgtaattgttcacgcaaaagcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47592958 |
ttcttagaagtctcagctattgaagaatcctacaacaacataatgatcatgcatgcacataatcacatgaaacaggttcgtaattgttcacgcaaaagcc |
47592859 |
T |
|
| Q |
104 |
taatcacaaataaaaatgcaacgtaagccctagtatcccataccccacatctgacattcattttgtgcaggcatatgcaatgaagtggaggctgagctta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592858 |
taatcacaaataaaaatgcaacgtaagccctagtatcccataccccacatctgccattcattttgtgcaggcatatgcaatgaagtggaggctgagctta |
47592759 |
T |
|
| Q |
204 |
ccggattatcttcattgtgtgtttcttctttctttatggtttcttcagggat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592758 |
ccggattatcttcattgtgtgtttcttctttctttatggtttcttcagggat |
47592707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University