View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8812_low_5 (Length: 239)
Name: NF8812_low_5
Description: NF8812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8812_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 8448585 - 8448662
Alignment:
| Q |
12 |
gagaagaagaagatatacctcgacttcactatggagagattgagatttcagttcgaaactgatgaacaaaattgaagt |
89 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8448585 |
gagatgaagaagatatacctcgacttcactatggagagattgagattttagttcgaaactgatgaacaaaattgaagt |
8448662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 191
Target Start/End: Original strand, 8236333 - 8236407
Alignment:
| Q |
118 |
acataagaaagatgggtgagattcgttcaatgagatgatgtatttatattactaatgtgacaa-tttatcctcaa |
191 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| |||||||| | ||| |||| ||| ||||||||||| |
|
|
| T |
8236333 |
acataagaaagatgggtgagattggttccatgagatgatatatttatagtgctagtgtggcaattttatcctcaa |
8236407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 8236211 - 8236264
Alignment:
| Q |
20 |
gaagatatacctcgacttcactatggagagattgagatttcagttcgaaactga |
73 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
8236211 |
gaagatatacctcaactttgcttgggagagattgagattttagttcgaaactga |
8236264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University