View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8813_low_2 (Length: 433)
Name: NF8813_low_2
Description: NF8813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8813_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 1 - 427
Target Start/End: Complemental strand, 24926425 - 24925999
Alignment:
| Q |
1 |
ataggcctggagttccgagttcgagatcagcttctgttgaggcgactagcaatactaaatctagaaggcagtctaacacaccttcgaaaggacgtgcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24926425 |
ataggcctggagttccgagttcgagatcagcttctgttgaggcgactagcaatactaaatctagaaggcagtctaatacaccttcgaaaggacgtgcttc |
24926326 |
T |
|
| Q |
101 |
aaccgggttcactcacaataatcacagctcattgcatgctttgattagagctcgtttcaccgatggtgacgaagatagccctgttgtaattgggacaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24926325 |
aaccgggttcactcacaataatcatagctcattgcatgctttgagtagagctcgtttcaccgatggtgacgaagatagccctgttgtaattggtacaaag |
24926226 |
T |
|
| Q |
201 |
atggtcgaaagagtagtaaacatgagaaaacttgcaccaccaaagcatgacggcccttgcgccaacaacaattcttatggcaaatcttcatctggcagct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24926225 |
atggtcgaaagagtagtaaacatgagaaaacttgcaccaccaaagcatgacgacccttgcgccaacaacaattcatatggcaaatcttcatctggcagct |
24926126 |
T |
|
| Q |
301 |
ctggattcggaagtacgctttcaaagaagtctttagatatggcaatgaggcatatggtatgttcataactccattgcttatatgttctgctactgatttt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24926125 |
ctggattcggaagtacgctttcaaagaagtctttagatatggcaatgaggcatatggtatgttcataactccattgcttatatgttctgctactgatttt |
24926026 |
T |
|
| Q |
401 |
gtagttttcattaatgagtataatcta |
427 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24926025 |
gtagttttcattaatgagtataatcta |
24925999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University