View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8816_high_3 (Length: 208)

Name: NF8816_high_3
Description: NF8816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8816_high_3
NF8816_high_3
[»] chr3 (1 HSPs)
chr3 (22-194)||(32883404-32883576)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 32883576 - 32883404
Alignment:
22 aacccttcattgatcatcattgctcaacatattttaactcttgtagaagtgtccagggaatgtctaagtaaagaaaagaaaaaatgcttttatcgggaca 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
32883576 aacccttcattgatcatcattgctcaacatattttaactcttgtagaagtgtccagggaatgtctaagtaaagaaaagaaaaaatgcttttatcgggata 32883477  T
122 cttatttgagttatgggaggagtgtcctacgagtgtcggccacagagacacgcctaatctcagagatgtccat 194  Q
    |||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||    
32883476 cttatttgagctatgggaggagtgtcctatgagtgtcggccacaaagacacgcctaatctcagaggtgtccat 32883404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University