View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8816_high_3 (Length: 208)
Name: NF8816_high_3
Description: NF8816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8816_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 32883576 - 32883404
Alignment:
| Q |
22 |
aacccttcattgatcatcattgctcaacatattttaactcttgtagaagtgtccagggaatgtctaagtaaagaaaagaaaaaatgcttttatcgggaca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32883576 |
aacccttcattgatcatcattgctcaacatattttaactcttgtagaagtgtccagggaatgtctaagtaaagaaaagaaaaaatgcttttatcgggata |
32883477 |
T |
|
| Q |
122 |
cttatttgagttatgggaggagtgtcctacgagtgtcggccacagagacacgcctaatctcagagatgtccat |
194 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
32883476 |
cttatttgagctatgggaggagtgtcctatgagtgtcggccacaaagacacgcctaatctcagaggtgtccat |
32883404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University