View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8817_low_4 (Length: 293)
Name: NF8817_low_4
Description: NF8817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8817_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 4395920 - 4395806
Alignment:
| Q |
4 |
tttggtggtg-atgtgcgtgagttggattagaagacctaacttgtctatttactcttttttatgagataataagtgaatcgttggttttttagccacctt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395920 |
tttggtggtggatgtgcgtgagttggattaaaagacctaacttgttcatttacacttttttatgagataataagtgaatcgttggttttttagccacctt |
4395821 |
T |
 |
| Q |
103 |
atttgctctttatct |
117 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4395820 |
atttgctctttatct |
4395806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 275
Target Start/End: Complemental strand, 4395746 - 4395648
Alignment:
| Q |
177 |
gatttacgcatttgtgaaaggtcaaaagaaccacgatctaataagtgtttagtttgagtctacttaacatataacaaaatattgagaccccgtaaatgg |
275 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4395746 |
gatttacgcatttgtgaaaggtcaaaacaactgcgatctaataaatatttggtttgagtctacttaacatataacaaaatattgagaccccataaatgg |
4395648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 11743775 - 11743735
Alignment:
| Q |
38 |
cctaacttgtctatttactcttttttatgagataataagtg |
78 |
Q |
| |
|
|||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
11743775 |
cctatcttgtccatttactcttttttattagataataagtg |
11743735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University