View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8817_low_5 (Length: 289)
Name: NF8817_low_5
Description: NF8817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8817_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 7153377 - 7153157
Alignment:
| Q |
18 |
agtctaaaccatctatagtttgttgccttattctatctgcaaatggttgctcaaagatggacgtgtttctttggtccttgctctctcttttttcattgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153377 |
agtctaaaccatctatagtttgttgccttattctatctgcaaatggttgctcaaagatggacgtgtttctttggtccttgctctctcttttttcattgat |
7153278 |
T |
|
| Q |
118 |
ctcttttttagttcccctc-cccctatacatcgtccttctcaaaaatttggatgtttaaatttatttgattttaattgaacatcttaaaatcaaattcat |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153277 |
ctcttttttagttcccctcccccctatacatcgttcttctcaaaaatttggatgtttaaatttatttgattttaattgaacatcttaaaatcaaattcat |
7153178 |
T |
|
| Q |
217 |
ttactagtgttagatacaata |
237 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
7153177 |
ttcctagtgttagatacaata |
7153157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 7159670 - 7159610
Alignment:
| Q |
51 |
tatctgcaaatggttgctcaaagatggacgtgtttctttggtccttgctctctcttttttc |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
7159670 |
tatctgcaaatggttgctcaaagaaagacatgtttgtttggtctttgctctctcttttttc |
7159610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 81 - 115
Target Start/End: Complemental strand, 7166834 - 7166800
Alignment:
| Q |
81 |
tgtttctttggtccttgctctctcttttttcattg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166834 |
tgtttctttggtccttgctctctcttttttcattg |
7166800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 105
Target Start/End: Complemental strand, 1353316 - 1353245
Alignment:
| Q |
34 |
agtttgttgccttattctatctgcaaatggttgctcaaagatggacgtgtttctttggtccttgctctctct |
105 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
1353316 |
agtttgttgcctcattctatcagcatatggttgttcaaagacgggtatgtttctttggtccttgctctctct |
1353245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University