View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8820_high_14 (Length: 228)
Name: NF8820_high_14
Description: NF8820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8820_high_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 47729583 - 47729809
Alignment:
| Q |
1 |
ttatgcttgtggccccatgtgccattcacattctctgcatcaggggcaaccaaggctcttggcatatctgaacccaaaattaagtacacaaaaaccataa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47729583 |
ttatgcctgtggccccatgtgccattcacattctctgcatcaggggcaaccaaggctcttggcatatctga-cccaaaattaagtacacaaaaaccataa |
47729681 |
T |
 |
| Q |
101 |
tggcaaacatcaaatttcatcaaactccactagtgtccaagggcggttttaccacccgacgagcctgggcacatgcccggacttaacccatgcnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47729682 |
tggcaaacatcaaatttcatcaaactccactggtgtctaagggcggttttaccacccggcgagcctgggcacatgcccggacttaacccatgctttcttt |
47729781 |
T |
 |
| Q |
201 |
gtatcattacaagaaatttgatttgact |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47729782 |
gtatcattacaagaaatttgatttgact |
47729809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 22729220 - 22729269
Alignment:
| Q |
142 |
ggcggttttaccacccgacgagcctgggcacatgcccggacttaacccat |
191 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| ||| ||||||||| |
|
|
| T |
22729220 |
ggcggttttaccacccgacgagcctggacatatgcctggatttaacccat |
22729269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 28841137 - 28841186
Alignment:
| Q |
142 |
ggcggttttaccacccgacgagcctgggcacatgcccggacttaacccat |
191 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||| || ||||||||| |
|
|
| T |
28841137 |
ggcggttttacaacccgacgagcctggacatatgcccagatttaacccat |
28841186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 10985435 - 10985400
Alignment:
| Q |
140 |
agggcggttttaccacccgacgagcctgggcacatg |
175 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10985435 |
agggcggttttaccacccggcgagcctgggcacatg |
10985400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 179
Target Start/End: Complemental strand, 30559978 - 30559940
Alignment:
| Q |
141 |
gggcggttttaccacccgacgagcctgggcacatgcccg |
179 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30559978 |
gggcggttttaccacctggcgagcctgggcacatgcccg |
30559940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University