View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8820_low_19 (Length: 257)
Name: NF8820_low_19
Description: NF8820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8820_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 34962383 - 34962606
Alignment:
| Q |
20 |
gagtgttgtcacgcgccaccacactctcctccctccctcgtctcaacaaacttcatcgtgaacatctcaccaatggcgcttccatcctctccgtgaaatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962383 |
gagtgttgtcacgcgccaccacactctcctccctccctcgtctcaacaaacttcatcgtgaacatctcaccaatggcgcttccatcctctccgtgaaatc |
34962482 |
T |
 |
| Q |
120 |
gatcggatcagtctctgatggcgggaaccttgtctttggaagacaacttcgtcctgaactctgttcacctgctcttaagaaaagtggtgtactcctccgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962483 |
gatcggatcagtctctgatggcgggaaccttgtctttggaagacaacttcgtcctgaactctgttcacctgctcttaagaaaagtggtgtactcctccgt |
34962582 |
T |
 |
| Q |
220 |
ccttgcctcgctgctgccgatgat |
243 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
34962583 |
ccttgcctcgccgctgccgatgat |
34962606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University