View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8820_low_21 (Length: 241)
Name: NF8820_low_21
Description: NF8820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8820_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 7569021 - 7569219
Alignment:
| Q |
19 |
ggctctagtttgatttctctttttatttttgtttggacacttgagtctaacatgattttgtaattgtgaattttgttttattcaatgagaaaacttatga |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7569021 |
ggctctagtttgatttctctttttgtttttgtttagacacttgagtctaac------ttgtaattgtgaattttgttttattcaatgagaaaacttatga |
7569114 |
T |
 |
| Q |
119 |
tcattgtcaacatgtacgtatttgagaaaatctatgcataatcctttttcttttctaatcttctttcttgttgggaatcgatctaaatttttcctactcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7569115 |
tcattgtcaacatgtacgtatttgagaaaatctatgcataatcctttttcttttctaatcttctttcttgttgggaatcgatctaaattttttctactcc |
7569214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University